We narrowed to 24,612 results for: crispr
-
Plasmid#232631Purposecatalytically inactive dCas9 for localization; labeled with tdTomatoDepositorInsertdCas9-tdTomato
UseCRISPRTagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cas9-T2A-H2B mCitirine
Plasmid#210471PurposeCoexpression of Cas9 and H2B mCitrineDepositorInsertCas9-T2A-H2B mCitirine
UseCRISPR and Synthetic BiologyTagsmCitrine on C terminal of H2BExpressionMammalianMutationCas9 contains 3xFLAG tag and nuclear localization…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNR2F1-donor
Plasmid#112388PurposeCRISPR donor plasmid to tag human transcription factor NR2F1 with GFPDepositorInsertNR2F1 homology arms flanking EGFP-IRES-Neo cassette (NR2F1 Human)
UseCRISPRMutationrs974916569Available SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF250-donor
Plasmid#112383PurposeCRISPR donor plasmid to tag human transcription factor ZNF250 with GFPDepositorInsertZNF250 homology arms flanking EGFP-IRES-Neo cassette (ZNF250 Human)
UseCRISPRMutationhg38:8:144882271:C>G,hg38:8:144882273:T>CAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF140-donor
Plasmid#112363PurposeCRISPR donor plasmid to tag human transcription factor ZNF140 with GFPDepositorInsertZNF140 homology arms flanking EGFP-IRES-Neo cassette (ZNF140 Human)
UseCRISPRMutationhg38:12:133105834:A>G, hg38:12:133105852:A>GAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF639-donor
Plasmid#112345PurposeCRISPR donor plasmid to tag human transcription factor ZNF639 with GFPDepositorInsertZNF639 homology arms flanking EGFP-IRES-Neo cassette (ZNF639 Human)
UseCRISPRMutationhg38:3:179333542:G>T,rs978050614Available SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTBPL1-donor
Plasmid#112316PurposeCRISPR donor plasmid to tag human transcription factor TBPL1 with GFPDepositorInsertTBPL1 homology arms flanking EGFP-IRES-Neo cassette (TBPL1 Human)
UseCRISPRMutationrs35776966, hg38:6:133987646:GTGTAT>-Available SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-2
Plasmid#74436PurposesgRNA expression vector for mouse Dedd gene targeting intron 4DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFE-Puro
Plasmid#170069PurposeExpresses S. pyogenes CRISPR chimeric RNA element (with F+E modifications) with customizable gRNA from U6 promoter and puromycin resistance from EFS-NS promoterDepositorInsertCas9 guide RNA scaffold with the F+E scaffold modification
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA900
Plasmid#122237PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs2 incorporated at the 3' end of the sgRNA constant region.DepositorInsertsgRNA with cs2 at the 3' end of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX458M-53BP1-DN1S
Plasmid#131045PurposePlasmid encoding Cas9-53BP1-DN1S fusion with BbsI restriction sites for insertion of guide RNA sequence.DepositorInsertSpCas9-53BP1-DN1S (TP53BP1 Human)
UseCRISPRTagsGFP and SpCas9ExpressionMammalianMutationOnly expressing residues 1231-1644 of complete 53…PromoterCBHAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1-SpRY (pBM1571)
Plasmid#170105PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-SpRY-nCas9(D10A)-P2A-EGFPDepositorInsertrAPOBEC1(R33A)-SpRY-nCas9(D10A)-P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationR33A in rAPOBEC1 and SpRY-nCas9 (D10A/A61R/L1111R…PromoterCMVAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
TETv4
Plasmid#167983PurposeExpresses TETv4 (TET1CD-XTEN80-dCas9-3xNLS-P2A-BFP) downstream of the CAG promoterDepositorInsertTETv4 (TET1CD-XTEN80-dCas9)
UseCRISPR and Synthetic BiologyTags3xNLS, TET1 catalytic domain, and tagBFPExpressionMammalianPromoterCAGAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJR85
Plasmid#140095PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region. BsmBI sites were removed to allow for programmed dual sgRNA library cloning.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
TetO-dCas9-D3A
Plasmid#78254PurposeExpresses dead Cas9 (dCas9) fused to DNMT3A catalytic domain (CD) linked to IRES-mCherry under the control of TetOp and a minimal CMV promoterDepositorInsertDNMT3A CD aa 598-912 (DNMT3A Human)
UseCRISPRTagsFlag epitope tagExpressionMammalianPromoterCMVAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-PE2-His (IK1822)
Plasmid#170103PurposeT7 promoter bacterial expression plasmid for PE2 (nSpCas9(H840A)-MMLV-RT) with C-terminal 6xHis-tag and bipartite NLSDepositorInsertbpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis
UseCRISPRTags6xHis tagExpressionBacterialMutationBacteria codon-optimized nSpCas9 (H840A) & M-…PromoterT7Available SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC013 - Twinstrep-SUMO-huLwCas13a
Plasmid#90097PurposeTwinstrep-SUMO-huLwCas13a for recombinant protein bacterial expression. Insert is human codon optimized but expresses well in bacteria.DepositorInsertLwCas13a
UseCRISPRTags6xHis-Twin Strep-SUMOExpressionBacterialAvailable SinceJune 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits