We narrowed to 3,856 results for: biorxiv
-
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1AR-7xsfGFP11-HA-HDR-donor
Plasmid#221832PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1AR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1AR homology arms
UseCRISPRExpressionInsect and MammalianAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2BR-7xsfGFP11-HA-HDR-donor
Plasmid#221833PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT2BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1BR-7xsfGFP11-HA-HDR-donor
Plasmid#221837PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor
Plasmid#221838PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoform D) homology arms
UseCRISPRExpressionInsect and MammalianAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET29b-Rhobin9
Plasmid#239019PurposeBacterial overexpression of de novo Rhodamine binder 9 (Rhobin2) proteinDepositorPublicationInsertRhoBin9
Tags6xHisExpressionBacterialPromoterT7Available sinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
P-d22bp
Plasmid#235657PurposeB. thetaiotaomicron fusA2 expression reporter lacking 22bp Cur binding siteDepositorInsertBacteroides thetaiotaomicron fusA2 promoter lacking the 22bp Cur binding site
MutationThe B. thetaiotaomicron fusA2 promoter lacking &q…Available sinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD 11W D262V
Plasmid#234618PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with partial W mutantDepositorInserthnRNPA1_LCD_11W D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationF202W, F210W, F216W, F222W, F228W, Y237W, Y244W, …PromoterT7Available sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3D+3N
Plasmid#234614PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_3DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250NPromoterT7Available sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4N
Plasmid#234611PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_4DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250N, D262NPromoterT7Available sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4V
Plasmid#234610PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to valineDepositorInserthnRNPA1_LCD_4DV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214V, D242V, D250V, D262VPromoterT7Available sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3D+3V
Plasmid#234613PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 aspartates mutated to valineDepositorInserthnRNPA1_LCD_3DV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214V, D242V, D250VPromoterT7Available sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E3GFP
Plasmid#233008PurposeGalactose iduced expression of Gcn4 E+GFP in yeastDepositorInsertGcn4 E+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationD105E, D118E, D139EPromoterGal1Available sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_FL Gcn4
Plasmid#232955PurposeGalactose iduced expression of full-length Gcn4 in yeastDepositorInsertGcn4
TagsTEV cleavage siteExpressionYeastPromoterGal1Available sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRHA
Plasmid#232994PurposeGalactose iduced expression of Gcn4 SATtoG KtoRHAin yeastDepositorInsertGcn4 SATtoG KtoR
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro3+HA
Plasmid#232990PurposeGalactose iduced expression of Gcn4 Aro3+HA in yeastDepositorInsertGcn4 Aro3+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD103Y, N112T, L113Y, S117F, K140RPromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only