We narrowed to 28,309 results for: cmv promoter
-
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
MPC021: CamKII CMV_sNovArch_citrine (soma targeting)
Plasmid#153194Purposeencoded soma targeted NovArchDepositorInsertsNovArch
TagscitrineExpressionMammalianAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV Ub Lex VP16 (F442A) HA (P#1711)
Plasmid#14596DepositorInsertLexA
TagsHA, Ubiquitin, and VP16 (F442A)ExpressionMammalianMutationThe VP16 sequence contains an F442A mutation. The…Available SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NTOM20-SbMVpC-43LK-iLID(139)-NES-NES-SbMVpN-iLID-SbMVseq-bArr2-TevCs-P2A-EGFP
Plasmid#210505Purposeexpresses NTOM20-SbMVpC-43LK-iLID(139)-NES-NES-SbMVpN-iLID-SbMVseq-bArr2-TevCs-P2A-EGFP component in mammalian cellsDepositorInsertNTOM20-SbMVpC-43LK-iLID(139)-NES-NES-SbMVpN-iLID-SbMVseq-bArr2-TevCs-P2A-EGFP
ExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD790 HBS CMV_Min DsRE2 and Dox-HIF1a
Plasmid#253879PurposeIntegration Vector for DsRE2 reporter with the HBS (CMV_min) promoter (TUPV1), HIF1_* with the TRE3GV promtor (TUPV2), and EBFP2-P2A-BlastR with the CAG promoter (TUPV3)DepositorInsertDsRE2, HIF1_*, EBFP2-P2A-BlastR
UseSynthetic BiologyExpressionMammalianPromoterHBS(CMV_min), TRE3GV, CAGAvailable SinceJune 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRZ334:CMVp-BD6-AS-(3'SE)-EC-Ex2-miRS2-BSs-pA
Plasmid#251326PurposeExpression of ECFP-Ex2 under CMVp promoter for use in synthetic gene circuitsDepositorInsertEC-Ex2
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRZ337:CMVp-mK2-Ex1-(5'D)-miRS2-(3'SE)-BD5-S-pA
Plasmid#251329PurposeExpression of mK2-Ex1 under CMVp promoter for use in synthetic gene circuitsDepositorInsertmK2-Ex1
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-TET-DIAL-minCMV)-mGL-bGH_pDA028
Plasmid#246363Purpose203-bp DIAL Reporter Plasmid with minCMV expressing mGreenLantern in the presence of DOX and rtTA and editable by Cre recombinaseDepositorInsertmGreenLantern
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-TET-DIAL-CMV53)-mGL-bGH_pDA046
Plasmid#246365Purpose203-bp DIAL Reporter Plasmid with CMV53 expressing mGreenLantern in the presence of DOX and rtTA and editable by Cre recombinaseDepositorInsertmGreenLantern
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-CNOT3-E95A-Tev-3xFlag
Plasmid#245726PurposeExpress CNOT3-E95A-Tev-3xFlag in mammalian cellsDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-CNOT3-K105S-Tev-3xFlag
Plasmid#245727PurposeExpress CNOT3-K105S-Tev-3xFlag in mammalian cellsDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-CNOT3-R59S-Tev-3xFlag
Plasmid#245725PurposeExpress CNOT3-R59S-Tev-3xFlag in mammalian cellsDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_HH-EMX1 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
Plasmid#176459PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting EMX1 driven by EF1alpha promoter and and EGFP(L138S)-P2A-mCherry driven by CMVDepositorInsertHH-EMX1 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRZ315:CMVp-BD6-AS (50bp)2mm(18-19)-(Canonical V13'SE)-mK2-Ex2-(linker4)-pA
Plasmid#251324PurposeExpression of mK2-Ex2 under CMVp promoter for use in synthetic gene circuitsDepositorInsertmK2-Ex2
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRZ366:CMVp-mK2-Ex1-miRS1-mK2-Ex2-PEST-miRS2-BSs-pA
Plasmid#251331PurposeExpression of mKate2 under CMVp promoter for use in synthetic gene circuitsDepositorInsertmKate2
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRZ335:CMVp-BD5-AS-(3'SE)-mK2-Ex2-miRS1-BSs-pA
Plasmid#251327PurposeExpression of mK2-Ex2 under CMVp promoter for use in synthetic gene circuitsDepositorInsertmK2-Ex2
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRZ386:CMVp-BD6-AS (50bp)2mm(18-19)-(Canonical 3'SE V1)-EC-Ex2-pA
Plasmid#251333PurposeExpression of ECFP-Ex2 under CMVp promoter for use in synthetic gene circuitsDepositorInsertEC-Ex2
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only