We narrowed to 3,704 results for: biorxiv
-
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9 UGT1 (pWZ594)
Plasmid#254037PurposeExpress SpCas9 and the UGT1 gRNADepositorInsertgRNA_UGT1
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9 LP400~3p (pKBA314)
Plasmid#254039PurposeExpress SpCas9 and the LP400~3p gRNADepositorInsertgRNA_LP400~3p
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9 UNS1 (pKBA244)
Plasmid#254040PurposeExpress SpCas9 and the UNS1 gRNADepositorInsertgRNA_UNS1
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9 UNS2 (pKBA235)
Plasmid#254041PurposeExpress SpCas9 and the UNS2 gRNADepositorInsertgRNA_UNS2
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSLQ12756-PHR-EF1a-puroR-T2A- anti-CD19 CAR-GS-mCherry-GFP1-10- leucine zipper
Plasmid#252639PurposeHuman expression vector containing EF1a promoter, anti-CD19 CAR that is fused to mCherry and GFP1-10 and puromycin resistance geneDepositorInsertanti-CD19 CAR-mCherry-GFP1-10-leucine-zipper, PuroR
UseLentiviralPromoterEF1aAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSLQ12774-PHR-EF1a-leucine zipper-GFP11-NES-2A-CD19 (no ICD)-P2A-puroR-2A-BFP-NLS
Plasmid#252642PurposeHuman expression vector containing EF1a promoter, GFP11 along with a leucine zipper, CD19 (no intracellular domain), nuclear BFP, and puromycin resistance geneDepositorInsertGFP11-leucine-zipper, CD19 (no ICD), PuroR, BFP-NLS
UseLentiviralPromoterEF1aAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-XRN2_sgRNA_1
Plasmid#242895PurposePiggyBac cargo vector with XRN2 sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NanoLuc-LATeNT(slow)
Plasmid#240995PurposeExpresses NanoLuc-LATeNT* in neurons; for AAV transductionDepositorInsertNanoLuc-V5-LATeNT*
UseAAVTagsV5 (internal)ExpressionMammalianAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-LATeNT
Plasmid#240988PurposeDox-inducible expression of LATeNT in the mammalian cytosol; lentiviral vectorDepositorInsertV5-LATeNT
UseLentiviralTagsV5ExpressionMammalianAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEx-tdT-P2A-Mxra8
Plasmid#242478PurposeAAV vector expressing Mxra8 and tdTomato under cre-recombinase controlDepositorAvailable SinceSept. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-hyg-OsAID (p5110)
Plasmid#239360PurposepPOTv7 based plasmid template for addition of a Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using hygromycinDepositorInsertsRice Auxin Inducible Degradation domain
Auxin Inducible Degradation domain
UseBacterialPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-puro-3Ty:OsAID:3Ty (p5229)
Plasmid#239361PurposepPOTv6 based plasmid template for addition of Ty-epitope tagged Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorInsertRice Auxin inducible degradation domain
UseBacterialTags3 x Ty epitope tagPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-hyg-AtAID:HA (p5339)
Plasmid#239363PurposepPOTv7 based plasmid template for addition of HA-epitope tagged Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using hygromycinDepositorInsertArabidopsis Auxin Inducible Degradation domain
UseBacterialTags1 x HA epitopePromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-hyg-3Ty:OsAID:3Ty (p5230)
Plasmid#239362PurposepPOTv6 based plasmid template for addition of Ty-epitope tagged Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorInsertRice Auxin inducible degradation domain
UseBacterialTags3 x Ty epitope tagPromotern/aAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mutCKAR3
Plasmid#238412PurposeMammalian expression of a phosphorylation deficient (T to A) mutant of CKAR3 under a CMV promotor.DepositorInsertphosphorylation deficient mutant of CKAR3 (T to A)
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pInducer20-HA-TEADiv2
Plasmid#228877PurposeTet-inducible lentiviral vector for expression of optimized 2xHA-TEAD inhibitor (TEADiv2)DepositorInsertTEADiv2
UseLentiviralTags2xHAAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6/TO-shEsr1-CMV-TetR-eGFP
Plasmid#233298PurposeDOX-inducible U6 driven shRNA against mouse Esr1DepositorAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_FL Gcn4
Plasmid#231855PurposeBacterial expression of N-terminally 6His tagged FL Gcn4DepositorInsertGcn4
Tags6xHis, TEV cleavage siteExpressionBacterialPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_eGFP-pScaC-MTS
Plasmid#228827PurposeFor the expression of the passenger domain of the Orientia tsutsugamushi protein ScaC C-terminally fused to a mitochondrial targeting sequence in HeLa Flp-In cellsDepositorInsertScaC
TagsMTS and eGFPExpressionMammalianMutationaa 33-223Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only