Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLH_Scr15
(Plasmid #100537)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100537 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pL1A0*B0*_Leu
  • Backbone size w/o insert (bp) 4885
  • Total vector size (bp) 11657
  • Vector type
    Yeast Expression, Cre/Lox, Synthetic Biology
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Phytochrome B
  • Alt name
    PhyB
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1863
  • Mutation
    N-terminal version of PhyB (AA 1-621)/ Mutation of nucleotide 576 C-->A
  • Entrez Gene
    PHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
  • Promoter TDH3
  • Tag / Fusion Protein
    • CreN (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAATAGCGCATCAAGAAAA
  • 3′ sequencing primer CCCTGAAATTATTCCCCTAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Phytochrome interacting factor 3
  • Alt name
    PIF3
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1572
  • Entrez Gene
    PIF3 (a.k.a. AT1G09530, F14J9.19, F14J9_19, PAP3, PHOTOCURRENT 1, PHYTOCHROME INTERACTING FACTOR 3, PHYTOCHROME-ASSOCIATED PROTEIN 3, POC1, phytochrome interacting factor 3, purple acid phosphatase 3)
  • Promoter FBA1
  • Tags / Fusion Proteins
    • SV40 NLS (C terminal on insert)
    • CreC (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCCTTCTTCTTCGCCCA
  • 3′ sequencing primer AAGAAAAGAGCCGACCAA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLH_Scr15 was a gift from Bernd Müller-Röber (Addgene plasmid # 100537 ; http://n2t.net/addgene:100537 ; RRID:Addgene_100537)
  • For your References section:

    L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast. Hochrein L, Mitchell LA, Schulz K, Messerschmidt K, Mueller-Roeber B. Nat Commun. 2018 May 22;9(1):1931. doi: 10.1038/s41467-017-02208-6. 10.1038/s41467-017-02208-6 PubMed 29789561