pXPA-fapO-RgTALsyn
(Plasmid
#100946)
-
PurposeExpression of Tyrosine Ammonia Lyase from constitutive GAP promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepXPA
-
Backbone manufacturerKoffas Lab - RPI
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6849
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRgTALsyn
-
Alt nameTyrosine Ammonia Lyase
-
Alt namePAL
-
Alt namePhenylalanine Ammonia Lyase
-
SpeciesRhodotorula glutinis
-
Insert Size (bp)2082
-
MutationSilent mutation to remove internal NdeI site on TAL
- Promoter GAP (Constitutive)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GCGGCGCATATGGCGCCTCGCCCGACTTC
- 3′ sequencing primer GCGGCGACTAGTTTATGCCAGCATCTTCAGCAGAACATTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPA-fapO-RgTALsyn was a gift from Mattheos Koffas (Addgene plasmid # 100946 ; http://n2t.net/addgene:100946 ; RRID:Addgene_100946) -
For your References section:
Complete Biosynthesis of Anthocyanins Using E. coli Polycultures. Jones JA, Vernacchio VR, Collins SM, Shirke AN, Xiu Y, Englaender JA, Cress BF, McCutcheon CC, Linhardt RJ, Gross RA, Koffas MAG. MBio. 2017 Jun 6;8(3). pii: e00621-17. doi: 10.1128/mBio.00621-17. 10.1128/mBio.00621-17 PubMed 28588129