Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #101039)


Item Catalog # Description Quantity Price (USD)
Plasmid 101039 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Feng Zhang lab
  • Backbone size (bp) 8506
  • Modifications to backbone
    Addition of T2A linker and Puromycin Resistance
  • Vector type
    Mammalian Expression, CRISPR
  • Promoter CBh
  • Selectable markers
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • T2A-Puro (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    eSpCas9(1.1) was a gift from Feng Zhang (Addgene plasmid # 71814)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9(1.1)-T2A-Puro was a gift from Andrea Németh (Addgene plasmid # 101039 ; ; RRID:Addgene_101039)