T7-CMVtrans-FFLuc-polyA
(Plasmid #101156)

• Purpose: Template for T7 RNAP production of RNA transcript for expression of firefly luciferase in a eukaryotic mammalian cell free lysate.
• Depositing Lab: Marcel Bruchez
• Publication: Canady et al J Am Chem Soc. 2015 Aug 19;137(32):10268-75. doi: 10.1021/jacs.5b05351. Epub 2015 Aug 4.

Backbone

• Vector backbone: Promega L482A
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 2678
• Total vector size (bp): 4331
• Modifications to backbone: Sequence modified from T7 promoter to ATG of the luciferase AGACCCAAGCTTTCAGATCCGCTAGCGCTACCGGGGATCCagccacc
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly luciferase
• Alt name: FFluc
• Species: Photinus pyralis
• Insert Size (bp): 1653
• Promoter: T7 promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AATACGCAAACCGCCTCTC
• 3′ sequencing primer: GGTGATGTCGGCGATATAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Promega

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is only for the production of transcript not for expression in mammalian cells.