Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #101787)


Item Catalog # Description Quantity Price (USD)
Plasmid 101787 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter minimal TATA-box promoter with low basal activity
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer ctaactggccggtacctgag
  • 3′ sequencing primer aacagtaccggattgccaag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4-AARE-luc2P-Hygro was a gift from Seiichi Oyadomari (Addgene plasmid # 101787 ; ; RRID:Addgene_101787)
  • For your References section:

    Skeletal muscle-specific eukaryotic translation initiation factor 2alpha phosphorylation controls amino acid metabolism and fibroblast growth factor 21-mediated non-cell-autonomous energy metabolism. Miyake M, Nomura A, Ogura A, Takehana K, Kitahara Y, Takahara K, Tsugawa K, Miyamoto C, Miura N, Sato R, Kurahashi K, Harding HP, Oyadomari M, Ron D, Oyadomari S. FASEB J. 2016 Feb;30(2):798-812. doi: 10.1096/fj.15-275990. Epub 2015 Oct 20. 10.1096/fj.15-275990 PubMed 26487695