Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDH-FLAG-R-Ras2
(Plasmid #102335)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102335 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDH
  • Backbone size w/o insert (bp) 7384
  • Total vector size (bp) 7999
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RRAS2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    615
  • GenBank ID
    NP_036382.2
  • Entrez Gene
    RRAS2 (a.k.a. NS12, TC21)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV
  • 3′ sequencing primer CTCTAGGCACCCGTTCAATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-FLAG-R-Ras2 was a gift from Hening Lin (Addgene plasmid # 102335 ; http://n2t.net/addgene:102335 ; RRID:Addgene_102335)
  • For your References section:

    SIRT6 regulates Ras-related protein R-Ras2 by lysine defatty-acylation. Zhang X, Spiegelman NA, Nelson OD, Jing H, Lin H. Elife. 2017 Apr 13;6. pii: e25158. doi: 10.7554/eLife.25158. 10.7554/eLife.25158 PubMed 28406396