pHR SFFVp MCP-mCherry IRES h2b-diRFP
(Plasmid
#102351)
-
PurposeLentiral expression vector bearing the MS2 Coat Protein (MCP) fused to mCherry as well as the nuclear marker histone 2b fused to two copies of irFP. Also bears the hygromycin selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102351 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2 Coat Protein
-
Alt nameMCP
- Promoter SFFV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttcccgagctctataaaagagc
- 3′ sequencing primer GATATCTCGAGTGCGGCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR SFFVp MCP-mCherry IRES h2b-diRFP was a gift from Jared Toettcher (Addgene plasmid # 102351 ; http://n2t.net/addgene:102351 ; RRID:Addgene_102351) -
For your References section:
Tracing Information Flow from Erk to Target Gene Induction Reveals Mechanisms of Dynamic and Combinatorial Control. Wilson MZ, Ravindran PT, Lim WA, Toettcher JE. Mol Cell. 2017 Sep 7;67(5):757-769.e5. doi: 10.1016/j.molcel.2017.07.016. Epub 2017 Aug 17. 10.1016/j.molcel.2017.07.016 PubMed 28826673