Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #102368)


Item Catalog # Description Quantity Price (USD)
Plasmid 102368 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pGTB Addgene 26197
  • Backbone manufacturer
    EM Callaway
  • Backbone size w/o insert (bp) 5655
  • Total vector size (bp) 7782
  • Modifications to backbone
    Replaced GFP-2A-TVA with TVA
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    TVA E2A-RG
  • Species
  • Insert Size (bp)
  • Promoter Ef1a

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ATTTGCCCTTTTTGAGTTTGG
  • 3′ sequencing primer GTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-FLEX-T-RG was a gift from Troy Margrie (Addgene plasmid # 102368)
  • For your References section:

    A Circuit for Integration of Head- and Visual-Motion Signals in Layer 6 of Mouse Primary Visual Cortex. Velez-Fort M, Bracey EF, Keshavarzi S, Rousseau CV, Cossell L, Lenzi SC, Strom M, Margrie TW. Neuron. 2018 Apr 4;98(1):179-191.e6. doi: 10.1016/j.neuron.2018.02.023. Epub 2018 Mar 15. 10.1016/j.neuron.2018.02.023 PubMed 29551490