pET15b-pknG
(Plasmid
#102814)
-
PurposeExpression of PknG in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET15b
- Backbone size w/o insert (bp) 5708
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepknG
-
SpeciesMycobacterium bovis BCG
- Promoter T7
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer T7 Fwd 5'd[TAATACGACTCACTATAGGG]3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Addgene's quality control sequencing has identified a frameshift mutation near the C-terminus of the pET-15b backbone-resident Lac-I ORF. However, the depositing lab states that this mutation does not affect PknG protein expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET15b-pknG was a gift from Jean Pieters (Addgene plasmid # 102814 ; http://n2t.net/addgene:102814 ; RRID:Addgene_102814) -
For your References section:
Protein kinase G from pathogenic mycobacteria promotes survival within macrophages. Walburger A, Koul A, Ferrari G, Nguyen L, Prescianotto-Baschong C, Huygen K, Klebl B, Thompson C, Bacher G, Pieters J. Science. 2004 Jun 18;304(5678):1800-4. Epub 2004 May 20. 10.1126/science.1099384 PubMed 15155913