Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pQE31-rsEGFP2
(Plasmid #102879)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102879 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE31
  • Backbone manufacturer
    QIAGEN
  • Backbone size w/o insert (bp) 3428
  • Total vector size (bp) 4148
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rsEGFP2
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • GenBank ID
    KC588954.1
  • Tag / Fusion Protein
    • 6xHisTag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGGATAACAATTTCACACAG
  • 3′ sequencing primer CGAGCGTTCTGAACAAATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQE31-rsEGFP2 was a gift from Stefan Jakobs (Addgene plasmid # 102879 ; http://n2t.net/addgene:102879 ; RRID:Addgene_102879)
  • For your References section:

    rsEGFP2 enables fast RESOLFT nanoscopy of living cells. Grotjohann T, Testa I, Reuss M, Brakemann T, Eggeling C, Hell SW, Jakobs S. elife. 2012;1:e00248. doi: 10.7554/eLife.00248. Epub 2012 Dec 31. 10.7554/eLife.00248 PubMed 23330067