pOTTC385 - pAAV CMV-IE IRES EGFP
(Plasmid
#102936)
-
PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA
-
Backbone manufacturerKarl Deisseroth
- Backbone size w/o insert (bp) 2890
- Total vector size (bp) 5250
-
Modifications to backbonereplaced EF1a promoter with CMV-IE, replaced DIO-hChR2-mCherry-WPRE_hGHpA with IRES-EGFP-SV40pA
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Alt nameEnhanced Green Fluorescent Protein
-
SpeciesSynthetic
-
Insert Size (bp)720
-
GenBank ID
- Promoter CMV-IE
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV F: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer SV40pA R: TTCAGGTTCAGGGGGAGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC385 - pAAV CMV-IE IRES EGFP was a gift from Brandon Harvey (Addgene plasmid # 102936 ; http://n2t.net/addgene:102936 ; RRID:Addgene_102936) -
For your References section:
Escalated Alcohol Self-Administration and Sensitivity to Yohimbine-Induced Reinstatement in Alcohol Preferring Rats: Potential Role of Neurokinin-1 Receptors in the Amygdala. Nelson BS, Fulenwider HD, Nennig SE, Smith BM, Sequeira MK, Chimberoff SH, Richie CT, Cheng K, Rice KC, Harvey BK, Heilig M, Schank JR. Neuroscience. 2019 Jun 23;413:77-85. doi: 10.1016/j.neuroscience.2019.06.023. 10.1016/j.neuroscience.2019.06.023 PubMed 31242442