PresentER-NLVPMVATV (GFP)
(Plasmid #102947)

• Purpose: PresentER minigene encoding HLA-A*02:01 ligand NLVPMVATV (GFP)
• Depositing Lab: David Scheinberg
• Publication: Gejman et al Cancer Immunol Res. 2020 May;8(5):672-684. doi: 10.1158/2326-6066.CIR-19-0745. Epub 2020 Mar 17.

Backbone

• Vector backbone: PresentER
• Backbone size w/o insert (bp): 8300
• Total vector size (bp): 8311
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin ; GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLVPMVATV
• Alt name: CMV pp65 HLA-A*02:01 epitope 495-503
• Alt name: pp65 495-503
• Species: Synthetic; Cytomegalovirus
• Insert Size (bp): 27
• GenBank ID:
• Promoter: LTR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: GTTCGACCCCGCCTCGATCC

Resource Information

• Supplemental Documents:
  • PresentER NLVPMVATV.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/22/267047 for bioRxiv preprint.