pAAV-synp-F-H2B-jRGECO1a
(Plasmid
#102995)
-
PurposeExpresses histone fused jRGECO1a under the synapsin promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 102995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 6505
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsAlthough Stable strains are highly recommended, regular strains (eg, DH5alpha) can be used for better yield.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-jRGECO1a
-
SpeciesH. sapiens (human), Synthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer GTCGACTCCGGAATAACTTCGTA (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/433953v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-synp-F-H2B-jRGECO1a was a gift from David Cox (Addgene plasmid # 102995 ; http://n2t.net/addgene:102995 ; RRID:Addgene_102995) -
For your References section:
Wide-area all-optical neurophysiology in acute brain slices. Farhi SL, Vicente VJ, Grama A, Yamagata M, Abdelfattah AS, Adam Y, Lou S, Kim JJ, Campbell RE, Cox DD, Cohen AE. bioRxiv 433953 10.1101/433953