pKSJ331
(Plasmid #103063)

• Purpose: Expresses colicin E1 and E1 immunity protein without E1 lysis (kil) gene
• Depositing Labs: Alan Finkelstein, Karen Jakes
• Publication: Kienker et al J Gen Physiol. 2008 Dec;132(6):693-707. doi: 10.1085/jgp.200810042.

Backbone

• Vector backbone: pUC19
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 2686
• Total vector size (bp): 4900
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): TG1
• Growth instructions: Use TG1 cells for expression. Induced colicin production with mitomycin C, 0.5 ug/ml
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Colicin E1 and E1 immunity protein
• Species: E. coli
• Insert Size (bp): 2100
• GenBank ID: J01566.1
• Promoter: colicin promotor from ColE1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: ggatatgatgtggtatctgat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert was cloned from ~base pair 5015 to ~500 of the circular ColE1 plasmid, where numbering begins within the colicin E1 gene. The ColE1 sequences include both the promoter for colicin E1 and for E1 immunity protein, which is transcribed in the opposite direction from the colicin gene. The cloned DNA does not include the intact kil (lysis protein) gene.