Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #104153)


Item Catalog # Description Quantity Price (USD)
Plasmid 104153 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    hCRTmE6mE7mL2 11-210
  • Alt name
  • Alt name
    MmuPV1 E6, MmuPV1 E7, MmuPV1 L2
  • Species
    H. sapiens (human); MmuPV1
  • Insert Size (bp)
  • Mutation
    residues 11 to 200 of the late protein L2
  • GenBank ID
  • Entrez Gene
    CALR (a.k.a. CRT, HEL-S-99n, RO, SSA, cC1qR)
  • Entrez Gene
    E6 (a.k.a. MmPv1_gp1)
  • Entrez Gene
    E7 (a.k.a. MmPv1_gp2)
  • Entrez Gene
    L2 (a.k.a. MmPv1_gp6)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GGGAAACGCCTGGTATCTTT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNGVL4a-hCRTmE6mE7mL2 was a gift from Richard Roden (Addgene plasmid # 104153 ; ; RRID:Addgene_104153)
  • For your References section:

    Spontaneous and Vaccine-Induced Clearance of Mus Musculus Papillomavirus 1 Infection. Jiang RT, Wang JW, Peng S, Huang TC, Wang C, Cannella F, Chang YN, Viscidi RP, Best SRA, Hung CF, Roden RBS. J Virol. 2017 Jul 12;91(15). pii: e00699-17. doi: 10.1128/JVI.00699-17. Print 2017 Aug 1. 10.1128/JVI.00699-17 PubMed 28515303