Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

AAV-FLEX-mCherry-FHA1-subT391A-mCherry
(Plasmid #104462)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104462 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV-FLEX
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6988
  • Modifications to backbone
    None
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mCherry-subT391A-FHA1-mCherry
  • Alt name
    mCherry-tagged PKA consensus substrate (with T391A mutation)
  • Species
    Synthetic
  • Insert Size (bp)
    1957
  • Promoter CAG
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer GAGGTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositing laboratory would like to note the presence of small sequence discrepancies, between the NGS result and their own reference sequence, in the second ITR. Please note that the depositing lab has only used this vector for in utero electroporation, and has not generated AAV from it

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-mCherry-FHA1-subT391A-mCherry was a gift from Bernardo Sabatini (Addgene plasmid # 104462 ; http://n2t.net/addgene:104462 ; RRID:Addgene_104462)
  • For your References section:

    Endogenous Galphaq-Coupled Neuromodulator Receptors Activate Protein Kinase A. Chen Y, Granger AJ, Tran T, Saulnier JL, Kirkwood A, Sabatini BL. Neuron. 2017 Dec 6;96(5):1070-1083.e5. doi: 10.1016/j.neuron.2017.10.023. Epub 2017 Nov 16. 10.1016/j.neuron.2017.10.023 PubMed 29154125