AAV-FLEX-mCherry-FHA1-subT391A-mCherry
(Plasmid
#104462)
-
PurposeCre-dependent, Non-phosphorylatable PKA consensus substrate tagged with mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV-FLEX
-
Backbone manufacturerScott Sternson
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6988
-
Modifications to backboneNone
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry-subT391A-FHA1-mCherry
-
Alt namemCherry-tagged PKA consensus substrate (with T391A mutation)
-
SpeciesSynthetic
-
Insert Size (bp)1957
- Promoter CAG
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer GAGGTTGATTATCGATAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositing laboratory would like to note the presence of small sequence discrepancies, between the NGS result and their own reference sequence, in the second ITR. Please note that the depositing lab has only used this vector for in utero electroporation, and has not generated AAV from it
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-FLEX-mCherry-FHA1-subT391A-mCherry was a gift from Bernardo Sabatini (Addgene plasmid # 104462 ; http://n2t.net/addgene:104462 ; RRID:Addgene_104462) -
For your References section:
Endogenous Galphaq-Coupled Neuromodulator Receptors Activate Protein Kinase A. Chen Y, Granger AJ, Tran T, Saulnier JL, Kirkwood A, Sabatini BL. Neuron. 2017 Dec 6;96(5):1070-1083.e5. doi: 10.1016/j.neuron.2017.10.023. Epub 2017 Nov 16. 10.1016/j.neuron.2017.10.023 PubMed 29154125