pET28b – E. coli RecE residues 564-868
(Plasmid
#104534)
-
PurposeExpresses E. coli RecE residues 564-868
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104534 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28b
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5368
- Total vector size (bp) 6280
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRecE residues 564-866 (C-terminal nuclease domain)
-
SpeciesE. coli
-
Insert Size (bp)912
- Promoter T7
-
Tag
/ Fusion Protein
- 6X-His tag followed by thrombin site
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer T7-F TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28b – E. coli RecE residues 564-868 was a gift from Charles Bell (Addgene plasmid # 104534 ; http://n2t.net/addgene:104534 ; RRID:Addgene_104534) -
For your References section:
Crystal structure of E. coli RecE protein reveals a toroidal tetramer for processing double-stranded DNA breaks. Zhang J, Xing X, Herr AB, Bell CE. Structure. 2009 May 13;17(5):690-702. doi: 10.1016/j.str.2009.03.008. 10.1016/j.str.2009.03.008 PubMed 19446525