pUG-57
(Plasmid
#104714)
-
PurposeCloning Module
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 104714 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH41308
-
Backbone manufacturerself-made
- Backbone size w/o insert (bp) 2251
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUb10
-
Alt nameAT4G05320
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)236
-
Entrez GeneUBQ10 (a.k.a. AT4G05320, C17L7.240, C17L7_240, UBI10, polyubiquitin 10, ubiquitin 10)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer moclof, agcgaggaagcggaagagcg
- 3′ sequencing primer moclor, gccacctgacgtctaagaaacc (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
release insert with BsaI and clone to Level 1 cloning vector
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUG-57 was a gift from Marco Trujillo (Addgene plasmid # 104714 ; http://n2t.net/addgene:104714 ; RRID:Addgene_104714) -
For your References section:
UbiGate: a synthetic biology toolbox to analyse ubiquitination. Kowarschik K, Hoehenwarter W, Marillonnet S, Trujillo M. New Phytol. 2018 Mar;217(4):1749-1763. doi: 10.1111/nph.14900. Epub 2017 Nov 30. 10.1111/nph.14900 PubMed 29194629