-
PurposeTo study effect of Kindlin 2 on Cell/ECM adhesion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 105305 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-NV
-
Backbone manufacturermodified pEGFP-N1. GFP is in BamH1 and Not 1 sites
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKindlin2
-
Alt nameFERMT2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2100
-
GenBank IDNM_006832
-
Entrez GeneFERMT2 (a.k.a. KIND2, MIG2, PLEKHC1, UNC112, UNC112B, mig-2)
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer AATGTCGTAACAACTCCGCCCC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
Original Kindlin 2 (FERMT2) cDNA was from OriGene, Cat no. SC320413.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP Kindlin2 was a gift from Kenneth Yamada (Addgene plasmid # 105305 ; http://n2t.net/addgene:105305 ; RRID:Addgene_105305)