This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV_hSyn1-SIO-stGtACR1-FusionRed
(Plasmid #105678)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105678 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4606
  • Total vector size (bp) 6469
  • Modifications to backbone
    directional Cre-Lox sites
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use recA deficient growth strain to prevent homologous recombination.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    stGtACR1
  • Alt name
    soma-targeted Guillardia theta anion-conducting channelrhodopsin 1
  • Species
    Synthetic; Guillardia theta
  • Insert Size (bp)
    1851
  • Promoter hSyn1
  • Tags / Fusion Proteins
    • FusionRed (N terminal on insert)
    • Kv2.1 (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAGCGCTGCCTCAGTCTGC
  • 3′ sequencing primer CACATAGCGTAAAAGGAGCAAC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/12/08/225847 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hSyn1-SIO-stGtACR1-FusionRed was a gift from Ofer Yizhar (Addgene plasmid # 105678 ; http://n2t.net/addgene:105678 ; RRID:Addgene_105678)
  • For your References section:

    High-efficiency optogenetic silencing with soma-targeted anion-conducting channelrhodopsins. Mahn M, Gibor L, Patil P, Cohen-Kashi Malina K, Oring S, Printz Y, Levy R, Lampl I, Yizhar O. Nat Commun. 2018 Oct 8;9(1):4125. doi: 10.1038/s41467-018-06511-8. 10.1038/s41467-018-06511-8 PubMed 30297821