xyl8.1
(Plasmid
#107214)
-
PurposeXylanase design 8.1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107214 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepETMBPH
- Total vector size (bp) 6263
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namexyl8.1
-
SpeciesSynthetic
-
Insert Size (bp)969
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site PstI (unknown if destroyed)
- 5′ sequencing primer ACTAGTGGTTCTGGTTCCGCGGGTG
- 3′ sequencing primer CCCGTTTAGAGGCCCCAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
xyl8.1 was a gift from Sarel Fleishman (Addgene plasmid # 107214 ; http://n2t.net/addgene:107214 ; RRID:Addgene_107214) -
For your References section:
Highly active enzymes by automated combinatorial backbone assembly and sequence design. Lapidoth G, Khersonsky O, Lipsh R, Dym O, Albeck S, Rogotner S, Fleishman SJ. Nat Commun. 2018 Jul 17;9(1):2780. doi: 10.1038/s41467-018-05205-5. 10.1038/s41467-018-05205-5 PubMed 30018322