Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

JGE301_pAAV-hSyn-DIO-Flag-hM3Dq-V2(2D)-ABIcs-mCherry
(Plasmid #107246)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107246 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV2
  • Backbone size w/o insert (bp) 6597
  • Total vector size (bp) 8454
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hM3DREADD
  • Alt name
    Gq DREADD
  • Species
    Synthetic
  • Insert Size (bp)
    1776
  • Mutation
    T to D and S to D mutations in V2-tail
  • Promoter hSYN
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • ABIcs (C terminal on insert)
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgctgcctcagtctgcggtg
  • 3′ sequencing primer ggagaaaatgaaagccatacgggaagcaatag
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/01/22/251769 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JGE301_pAAV-hSyn-DIO-Flag-hM3Dq-V2(2D)-ABIcs-mCherry was a gift from Bryan Roth (Addgene plasmid # 107246 ; http://n2t.net/addgene:107246 ; RRID:Addgene_107246)
  • For your References section:

    A Chemogenetic Platform for Spatio-temporal Control of β-arrestin Translocation and Signaling at G protein-Coupled Receptors. Roth BL, Gotoh Y, Giguere P, Nichols D. bioRxiv 251769 /10.1101/251769