-
PurposeExpression plasmid for 3xFLAG-tagged NIPBL
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepN3-3xFlag
- Backbone size w/o insert (bp) 4063
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNIPBL
-
Alt nameNIPBL cohesin loading factor
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)8385
-
Entrez GeneNipbl (a.k.a. Idn3)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CMV-for (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer SV40-pA-rev (CCTCACAAATGTGGTATGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid encodes the 2798 amino acid full-length murine NIPBL
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN3-Nipbl was a gift from Guntram Suske (Addgene plasmid # 107716 ; http://n2t.net/addgene:107716 ; RRID:Addgene_107716)