Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

UBQ10:sXVE:S10-(MCS)-3xHA
(Plasmid #108178)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108178 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    UBQ10:sXVE:GFPc:Kan
  • Backbone manufacturer
    Jörg Kudla
  • Backbone size (bp) 14556
  • Vector type
    Plant Expression, Synthetic Biology
  • Promoter UBQ10:sXVE:
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer cttcgcaagacccttcc
  • 3′ sequencing primer TCGCGTATTAAATGTATAATTGCGGGACTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UBQ10:sXVE:S10-(MCS)-3xHA was a gift from Tzu-Yin Liu (Addgene plasmid # 108178 ; http://n2t.net/addgene:108178 ; RRID:Addgene_108178)
  • For your References section:

    Detection of membrane protein-protein interaction in planta based on dual intein-coupled tripartite split-GFP association. Liu TY, Chou WC, Chen WY, Chu CY, Dai CY, Wu PY. Plant J. 2018 Feb 16. doi: 10.1111/tpj.13874. 10.1111/tpj.13874 PubMed 29451720