Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #108541)


Item Catalog # Description Quantity Price (USD)
Plasmid 108541 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    David Root Lab, addgene #25897
  • Backbone size w/o insert (bp) 9335
  • Total vector size (bp) 11484
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    PCDH7 transcript variant d
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    PCDH7 (a.k.a. BH-Pcdh, BHPCDH, PPP1R120)
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer catagcgtaaaaggagcaaca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX303-PCDH7-d was a gift from Kathryn O’Donnell (Addgene plasmid # 108541 ; ; RRID:Addgene_108541)
  • For your References section:

    PROTOCADHERIN 7 Acts through SET and PP2A to Potentiate MAPK Signaling by EGFR and KRAS during Lung Tumorigenesis. Zhou X, Updegraff BL, Guo Y, Peyton M, Girard L, Larsen JE, Xie XJ, Zhou Y, Hwang TH, Xie Y, Rodriguez-Canales J, Villalobos P, Behrens C, Wistuba II, Minna JD, O'Donnell KA. Cancer Res. 2017 Jan 1;77(1):187-197. doi: 10.1158/0008-5472.CAN-16-1267-T. Epub 2016 Nov 7. 10.1158/0008-5472.CAN-16-1267-T PubMed 27821484