Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAN19-3xFLAG-ccvTIR1-NOSt
(Plasmid #108546)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108546 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAN19
  • Backbone size w/o insert (bp) 2700
  • Total vector size (bp) 5000
  • Vector type
    Cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRANSPORT INHIBITOR RESPONSE 1 [F79G] fused with 3xFLAG and NOS terminator
  • Alt name
    ccvTIR1
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2118
  • Mutation
    Changed F79 to G
  • Entrez Gene
    TIR1 (a.k.a. AT3G62980, AtTIR1, TRANSPORT INHIBITOR RESPONSE 1)
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gccgattcattaatgcagctg
  • 3′ sequencing primer AAGGGGGATGTGCTGCAAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAN19-3xFLAG-ccvTIR1-NOSt was a gift from Keiko Torii (Addgene plasmid # 108546 ; http://n2t.net/addgene:108546 ; RRID:Addgene_108546)
  • For your References section:

    Chemical hijacking of auxin signaling with an engineered auxin-TIR1 pair. Uchida N, Takahashi K, Iwasaki R, Yamada R, Yoshimura M, Endo TA, Kimura S, Zhang H, Nomoto M, Tada Y, Kinoshita T, Itami K, Hagihara S, Torii KU. Nat Chem Biol. 2018 Mar;14(3):299-305. doi: 10.1038/nchembio.2555. Epub 2018 Jan 22. 10.1038/nchembio.2555 PubMed 29355850