pGEX6P1-hcGAS(157-522)
(Plasmid #108676)

• Purpose: For expression in E.coli and affinity purification of N-terminally GST-tagged human cGAS amino acid 157-522
• Depositing Labs: Andrew Jackson, Martin Reijns
• Publication: Mackenzie et al Nature. 2017 Aug 24;548(7668):461-465. doi: 10.1038/nature23449. Epub 2017 Jul 24.

Backbone

• Vector backbone: pGEX6P1
• Backbone manufacturer: Amersham
• Backbone size w/o insert (bp): 4984
• Total vector size (bp): 6072
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cGAS amino acid 157-522
• Species: H. sapiens (human)
• Insert Size (bp): 1101
• Mutation: contains amino acid 157-522
• Entrez Gene: CGAS (a.k.a. C6orf150, D4, MB21D1, h-cGAS)
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Resource Information

• Supplemental Documents:
  • pGEX6P1-hcGAS(157-522).gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry