Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTol2-hspDRv7_scGstlt
(Plasmid #108870)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108870 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Tol2
  • Backbone size w/o insert (bp) 10385
  • Vector type
    Tol2 integration into zebrafish genome

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    scGESTALT lineage tracing target V7
  • Alt name
    DRv7scGstlt
  • Species
    Synthetic
  • Insert Size (bp)
    324

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCGGACTCAGATCTCGAGCTCAAGCTT
  • 3′ sequencing primer CTGCCATTTGTCTCGAGGTCGAGAATTC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2-hspDRv7_scGstlt was a gift from Alex Schier (Addgene plasmid # 108870 ; http://n2t.net/addgene:108870 ; RRID:Addgene_108870)
  • For your References section:

    Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain. Raj B, Wagner DE, McKenna A, Pandey S, Klein AM, Shendure J, Gagnon JA, Schier AF. Nat Biotechnol. 2018 Mar 28. pii: nbt.4103. doi: 10.1038/nbt.4103. 10.1038/nbt.4103 PubMed 29608178