pLenti-LbCpf1-U6_FlipArray
(Plasmid
#109349)
-
PurposeLentiviral vector to express Cpf1 from EFS promoter, as well as a Cpf1 FlipArray from U6 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepY109
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 12630
- Total vector size (bp) 12720
-
Modifications to backboneModified U6 expression casette to be used for FlipArray.
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-FlipArray
-
Alt nameU6-DR-lox66-DR-BsmbIx2-lox71'-6T
-
SpeciesSynthetic
-
Insert Size (bp)137
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gagggcctatttcccatgat
- 3′ sequencing primer gggacagcagagatccagtttggT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-LbCpf1-U6_FlipArray was a gift from Sidi Chen (Addgene plasmid # 109349 ; http://n2t.net/addgene:109349 ; RRID:Addgene_109349) -
For your References section:
Programmable sequential mutagenesis by inducible Cpf1 crRNA array inversion. Chow RD, Kim HR, Chen S. Nat Commun. 2018 May 15;9(1):1903. doi: 10.1038/s41467-018-04158-z. 10.1038/s41467-018-04158-z PubMed 29765043