LZF40: LZF40_Fsyn_Cre
(Plasmid
#109378)
-
PurposeSynaptic transmission
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 109378 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonefsyn
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 9000
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeo marker is outside the LTRs and will not be packaged into virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre-NCBI
-
SpeciesSynthetic
-
Insert Size (bp)1029
- Promoter human synapsin I
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgtatgagtgcaagtgggttt
- 3′ sequencing primer atttgtgaaagattgactggtattctt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNCBI
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LZF40: LZF40_Fsyn_Cre was a gift from Adam Cohen (Addgene plasmid # 109378 ; http://n2t.net/addgene:109378 ; RRID:Addgene_109378) -
For your References section:
Voltage imaging and optogenetics reveal behaviour-dependent changes in hippocampal dynamics. Adam Y, Kim JJ, Lou S, Zhao Y, Xie ME, Brinks D, Wu H, Mostajo-Radji MA, Kheifets S, Parot V, Chettih S, Williams KJ, Gmeiner B, Farhi SL, Madisen L, Buchanan EK, Kinsella I, Zhou D, Paninski L, Harvey CD, Zeng H, Arlotta P, Campbell RE, Cohen AE. Nature. 2019 May 1. pii: 10.1038/s41586-019-1166-7. doi: 10.1038/s41586-019-1166-7. 10.1038/s41586-019-1166-7 PubMed 31043747