This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #110187)


Item Catalog # Description Quantity Price (USD)
Plasmid 110187 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4680
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    MeCP2_e2 FL [R111G] (mouse cDNA)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    Arg 111 Gly
  • Entrez Gene
    Mecp2 (a.k.a. 1500041B07Rik, D630021H01Rik, Mbd5, WBP10)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer aaatgtcgtaacaactccgc
  • 3′ sequencing primer acaaaccacaactagaatgcag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1_MeCP2(R111G) was a gift from Adrian Bird (Addgene plasmid # 110187 ; ; RRID:Addgene_110187)
  • For your References section:

    Radically truncated MeCP2 rescues Rett syndrome-like neurological defects. Tillotson R, Selfridge J, Koerner MV, Gadalla KKE, Guy J, De Sousa D, Hector RD, Cobb SR, Bird A. Nature. 2017 Oct 19;550(7676):398-401. doi: 10.1038/nature24058. Epub 2017 Oct 11. 10.1038/nature24058 PubMed 29019980