ins:MCS2; cryaa:RFP
(Plasmid
#110286)
-
Purpose(Empty Backbone) A zebrafish insulin promoter containing vector with a second multiple cloning sites. Contains red eye marker, and is flanked with I-SceI sites.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 110286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKS-insulin_cryaa:RFP
- Backbone size (bp) 6582
-
Modifications to backboneA multiple cloning site (MCS2) inserted downstream of the zebrafish insulin promoter.
-
Vector typeZebrafish
- Promoter insulin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ACACCCTGGTCATCATCCTG
- 3′ sequencing primer GCTTTATTTGTAACCATTATAAGCTGCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ins:MCS2; cryaa:RFP was a gift from Nikolay Ninov (Addgene plasmid # 110286 ; http://n2t.net/addgene:110286 ; RRID:Addgene_110286) -
For your References section:
Different developmental histories of beta-cells generate functional and proliferative heterogeneity during islet growth. Singh SP, Janjuha S, Hartmann T, Kayisoglu O, Konantz J, Birke S, Murawala P, Alfar EA, Murata K, Eugster A, Tsuji N, Morrissey ER, Brand M, Ninov N. Nat Commun. 2017 Sep 22;8(1):664. doi: 10.1038/s41467-017-00461-3. 10.1038/s41467-017-00461-3 [pii] PubMed 28939870