pLenti-xBE3-P2A-Puro
(Plasmid
#110870)
-
PurposeLentiviral vector for constitutive expression of xCas9(3.7)-BE3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAdapted from lentiCRISPRv1
- Backbone size w/o insert (bp) 6296
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namexCas9(3.7)-BE3
-
Alt namexCas9
-
SpeciesSynthetic
-
Insert Size (bp)5130
-
MutationD10A, A262T, R324L, S409I, E480K, E543D, M694I, E1219V
- Promoter EF1s
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAAGTGCAGTAGTCGCCGTG
- 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-xBE3-P2A-Puro was a gift from Lukas Dow (Addgene plasmid # 110870 ; http://n2t.net/addgene:110870 ; RRID:Addgene_110870) -
For your References section:
Optimized base editors enable efficient editing in cells, organoids and mice. Zafra MP, Schatoff EM, Katti A, Foronda M, Breinig M, Schweitzer AY, Simon A, Han T, Goswami S, Montgomery E, Thibado J, Kastenhuber ER, Sanchez-Rivera FJ, Shi J, Vakoc CR, Lowe SW, Tschaharganeh DF, Dow LE. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. 10.1038/nbt.4194 PubMed 29969439