This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Addgene will be closed November 22nd & 23rd for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 19th - 23rd. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti-xF2X-P2A-Puro
(Plasmid #110873)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110873 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Adapted from lentiCRISPRv1
  • Backbone size w/o insert (bp) 6296
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    xFNLS-2X(3.7)
  • Alt name
    xFNLS-2X
  • Species
    Synthetic
  • Insert Size (bp)
    5301
  • Mutation
    D10A, A262T, R324L, S409I, E480K, E543D, M694I, E1219V, and NLS sequence at the N-terminus and 2 tandem NLS sequences within the XTEN linker
  • Promoter EF1s
  • Tag / Fusion Protein
    • 3X FLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAAGTGCAGTAGTCGCCGTG
  • 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-xF2X-P2A-Puro was a gift from Lukas Dow (Addgene plasmid # 110873)
  • For your References section:

    Optimized base editors enable efficient editing in cells, organoids and mice. Zafra MP, Schatoff EM, Katti A, Foronda M, Breinig M, Schweitzer AY, Simon A, Han T, Goswami S, Montgomery E, Thibado J, Kastenhuber ER, Sanchez-Rivera FJ, Shi J, Vakoc CR, Lowe SW, Tschaharganeh DF, Dow LE. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. 10.1038/nbt.4194 PubMed 29969439