pUG-natNT2
(Plasmid
#110922)
-
Purposeexpression of nat gene conferring resistance to nourseothricin for gene deletion in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUG6
-
Backbone manufacturerGueldener et al Nucleic Acid Res 30(6):e23. 11884642
- Backbone size w/o insert (bp) 4009
- Total vector size (bp) 3852
-
Modifications to backboneThe natNT2 marker was cloned from pFA6a-natNT2 (Janke et al., 2004) to pUG6 via the SacI and BglII restriction sites, thereby replacing the KanMX4 marker, resulting inpUG-natNT2.
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersnourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenat
-
SpeciesStreptomyces noursei
-
Insert Size (bp)576
-
GenBank IDABB59019.1
- Promoter AgTEF1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer CCAGCTGAAGCTTCGTACGC
- 3′ sequencing primer GCATAGGCCACTAGTGGATCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJanke C, Magiera MM, Rathfelder N, Taxis C, Reber S, Maekawa H, Moreno-Borchart A, Doenges G, Schwob E, Schiebel E, Knop M. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast. 2004 Aug;21(11):947-62.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUG-natNT2 was a gift from Jean-Marc Daran (Addgene plasmid # 110922 ; http://n2t.net/addgene:110922 ; RRID:Addgene_110922) -
For your References section:
Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA co-expression plasmid. Juergens H, Varela JA, Gorter de Vries AR, Perli T, Gast VJM, Gyurchev NY, Rajkumar AS, Mans R, Pronk JT, Morrissey JP, Daran JG. FEMS Yeast Res. 2018 May 1;18(3). pii: 4847887. doi: 10.1093/femsyr/foy012. 10.1093/femsyr/foy012 PubMed 29438517