pAAV-hSyn-DIO {ChETA}on-WPRE
(Plasmid #111386)

• Purpose: AAV expression of ChETA (hChR2 with E123T/H134R mutations) fused to HA tag driven by hSynapsin promoter in Cre-ON manner for optogenetic activation
• Depositing Lab: Adam Kepecs
• Publication: Li et al Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4836
• Total vector size (bp): 5798
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChETA
• Alt name: hChR2(E123T/H134R)
• Species: Synthetic
• Insert Size (bp): 962
• Mutation: humanized ChR2, E123T/H134R
• Promoter: hSynapsin
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (destroyed during cloning)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CCAAATTGCGCATCCCCTATC
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Resource Information

• Supplemental Documents:
  • S11-pAAV-hSynDIO-ChetaHA_r.gb
• A portion of this plasmid was derived from a plasmid made by: pAAV-Ef1a-DIO-{ChETA-EYFP} vector from Deisseroth Lab (Addgene, Plasmid #26968)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry