pV1081
(Plasmid
#111425)
-
PurposeSolo vector for expression of CaCas9 and sgRNA for CaADE2 mutagenesis - integrates at ENO1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111425 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepV1025
-
Backbone manufacturerValmik Vyas
-
Vector typeYeast Expression, CRISPR
-
Selectable markersclonNAT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCaCas9/sgADE-NT2
-
gRNA/shRNA sequencecaacaatcatacgacctaat
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pV1081 was a gift from Gerald Fink (Addgene plasmid # 111425 ; http://n2t.net/addgene:111425 ; RRID:Addgene_111425) -
For your References section:
A CRISPR system permits genetic engineering of essential genes and gene families. Vyas VK, Barrasa MI, Fink GR. Sci Adv. 2015;1(3):e1500248. 10.1126/sciadv.1500248 PubMed 25977940