T5-sgRNA
(Plasmid
#113655)
-
PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYTK095
- Backbone size w/o insert (bp) 2906
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepromoter T5 and sgRNA
-
gRNA/shRNA sequenceGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
- Promoter T5
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T5-sgRNA was a gift from Jeffrey Barrick (Addgene plasmid # 113655 ; http://n2t.net/addgene:113655 ; RRID:Addgene_113655) -
For your References section:
Synthetic Genome Defenses against Selfish DNA Elements Stabilize Engineered Bacteria against Evolutionary Failure. Geng P, Leonard SP, Mishler DM, Barrick JE. ACS Synth Biol. 2019 Mar 15;8(3):521-531. doi: 10.1021/acssynbio.8b00426. Epub 2019 Feb 15. 10.1021/acssynbio.8b00426 PubMed 30703321