Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #113912)


Item Catalog # Description Quantity Price (USD)
Plasmid 113912 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 7383
  • Modifications to backbone
    PvuII digestion and re-ligation to delete non-essential element in p3-Sniper-Cas9.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3s-Sniper-Cas9 was a gift from Jungjoon Lee (Addgene plasmid # 113912 ; ; RRID:Addgene_113912)
  • For your References section:

    Directed evolution of CRISPR-Cas9 to increase its specificity. Lee JK, Jeong E, Lee J, Jung M, Shin E, Kim YH, Lee K, Jung I, Kim D, Kim S, Kim JS. Nat Commun. 2018 Aug 6;9(1):3048. doi: 10.1038/s41467-018-05477-x. 10.1038/s41467-018-05477-x PubMed 30082838