-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11392 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEYFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecell division cycle 42
-
Alt nameCdc42
-
Alt nameYFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)662
-
GenBank IDAF498962
-
Entrez GeneCDC42 (a.k.a. CDC42Hs, G25K, TKS)
-
Tag
/ Fusion Protein
- YFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CCTGAGCAAAGACCCCAACGAGAA
- 3′ sequencing primer CAGGGGGAGGTGTGGGAGGTTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHuman Cdc42 cDNA was obtained from the UMR cDNA Resource Center (www.cdna.org).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expresses Cdc42 with an N-terminal YFP marker. YFP is the monomeric (A207K) version of Citrine, a pH-insensitive YFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YFP-Cdc42 was a gift from Joel Swanson (Addgene plasmid # 11392 ; http://n2t.net/addgene:11392 ; RRID:Addgene_11392) -
For your References section:
Cdc42, Rac1, and Rac2 display distinct patterns of activation during phagocytosis. Hoppe AD, Swanson JA. Mol Biol Cell 2004 Aug;15(8):3509-19. Epub 2004 May 28. 10.1091/mbc.e03-11-0847 PubMed 15169870