pStA234
(Plasmid
#114173)
-
Purpose(Empty Backbone) Start-Stop Assembly Level 234 plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACYC177
- Backbone size (bp) 3040
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer OligoGT573 CCTCGGTGAGTTTTCTCCTTC
- 3′ sequencing primer OligoGT486 GATTACGCGCAGACCAAAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Accession Number MG649432, Alternative ID = pGT419 . Please visit https://www.biorxiv.org/content/early/2018/07/04/361626 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pStA234 was a gift from John Heap (Addgene plasmid # 114173 ; http://n2t.net/addgene:114173 ; RRID:Addgene_114173) -
For your References section:
Start-Stop Assembly: a functionally scarless DNA assembly system optimized for metabolic engineering. Taylor GM, Mordaka PM, Heap JT. Nucleic Acids Res. 2018 Nov 20. pii: 5193345. doi: 10.1093/nar/gky1182. 10.1093/nar/gky1182 PubMed 30462270