pStA0::crtI
(Plasmid
#114343)
-
PurposecrtI in pStA0
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGT400
- Backbone size w/o insert (bp) 2209
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecrtI (codon optimised)
-
Insert Size (bp)1644
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer OligoGT234 GGGGAAACGCCTGGTATCT
- 3′ sequencing primer OligoGT235 AGCAAAAACAGGAAGGCAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative ID = pGT356 . Please visit https://www.biorxiv.org/content/early/2018/07/04/361626 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pStA0::crtI was a gift from John Heap (Addgene plasmid # 114343 ; http://n2t.net/addgene:114343 ; RRID:Addgene_114343) -
For your References section:
Start-Stop Assembly: a functionally scarless DNA assembly system optimized for metabolic engineering. Taylor GM, Mordaka PM, Heap JT. Nucleic Acids Res. 2018 Nov 20. pii: 5193345. doi: 10.1093/nar/gky1182. 10.1093/nar/gky1182 PubMed 30462270