Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #114372)


Item Catalog # Description Quantity Price (USD)
Plasmid 114372 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5625
  • Total vector size (bp) 7317
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    anion channelrhodopsin 2
  • Insert Size (bp)
  • Entrez Gene
  • Promoter Ef1a
  • Tags / Fusion Proteins
    • EYFP (C terminal on insert)
    • Nlgn1C (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site BamHI, NheI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Ef1a-F)
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (WPRE-R)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Nlgn1C was a gift from Mingshan Xue (Addgene plasmid # 114372 ; ; RRID:Addgene_114372)
  • For your References section:

    Targeting light-gated chloride channels to neuronal somatodendritic domain reduces their excitatory effect in the axon. Messier JE, Chen H, Cai ZL, Xue M. Elife. 2018 Aug 9;7. pii: 38506. doi: 10.7554/eLife.38506. 10.7554/eLife.38506 PubMed 30091701