pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C
(Plasmid
#114375)
-
Purposeexpresses Flpo recombinase-dependent GtACR2-Kv2.1C, which targets GtACR2 to the somatodendritic compartment
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114375 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5622
- Total vector size (bp) 7413
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGtACR2-EYFP-Kv2.1C
-
Alt nameanion channelrhodopsin 2
-
Insert Size (bp)1791
-
Entrez GeneNEWENTRY
- Promoter Ef1a
-
Tags
/ Fusion Proteins
- EYFP (C terminal on insert)
- Kv2.1C (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (destroyed during cloning)
- 3′ cloning site BamHI, NheI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Ef1a-F)
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (WPRE-R) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBackbone vector from pAAV-EF1α-FRT-FLEX-GtACR2-EYFP (Addgene #114369)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/05/25/331165.1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C was a gift from Mingshan Xue (Addgene plasmid # 114375 ; http://n2t.net/addgene:114375 ; RRID:Addgene_114375) -
For your References section:
Targeting light-gated chloride channels to neuronal somatodendritic domain reduces their excitatory effect in the axon. Messier JE, Chen H, Cai ZL, Xue M. Elife. 2018 Aug 9;7. pii: 38506. doi: 10.7554/eLife.38506. 10.7554/eLife.38506 PubMed 30091701