1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 11453: pHMMa.PH0999
  • pyrazinamidase

  • 540

  • P. horikoshii

  • BAA30096 PH0999 NP_142913

  • PH0999 ()

  • pHMMa
    (Search Vector Database)

  • Bacterial Expression

  • 3188

  • NdeI

  • No

  • BamHI

  • No

  • TAATACGACTCACTATAGGG List of Sequencing Primers

  • GCTAGTTATTGCTCAGCGG

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Sung-Hou Kim

  • MTA

Comments: 

Please note that the plasmid pHMMa.PH0999 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Crystal structure and mechanism of catalysis of a pyrazinamidase from Pyrococcus horikoshii. Du et al (Biochemistry. 2001 Nov 27. 40(47):14166-72. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11453" in your Materials and Methods section.

Price: $65.00

This is commonly requested with