1
Plasmid 1148: pGALSc104(A503V/A509D)
  • HSP104

  • 5958

  • 2850

  • S. cerevisiae (budding yeast)

  • M67479

  • HSP104 (YLL026W)

  • A503V/A509D

  • pLA1 (pRS313:GAL1-10)
    (Search Vector Database)

  • Yeast Expression

  • 5703

  • BamHI

  • No

  • SacI

  • No

  • TACCTCTATACTTTAACGTC List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Susan Lindquist

  • UBMTA

This plasmid has not been sequence verified. Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Dominant gain-of-function mutations in Hsp104p reveal crucial roles for the middle region. Schirmer et al (Mol Biol Cell 2004 May;15(5):2061-72. Epub 2004 Feb 20. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 1148" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with